Sign in Register Submit Manuscript

Qingres Home

Location:Home >> Detail

Journal of Psychiatry and Brain Science 2016; 1(4): 3; https://doi.org/10.20900/jpbs.20160017

Article

Whole-Exome Sequencing Reveals Clinically Relevant Variants in Family Affected with Autism Spectrum Disorder

Author: Jiaxiu Zhou1, Feng Yang2, Xiaoge Li3*, Shaoming Zhou4, Fusheng He5, Jingwen Liang6, Yan Wang7, Mingbang Wang5,7,8,9* , Ruihuan Xu6*

1 Division of Psychology, Shenzhen Children’s Hospital, Shenzhen, Guangdong, China

2 Division of Shenzhen Children’s Hospital, Shenzhen, Guangdong, China

3 Tianjin Jinnan Xiaozhan Hospital

4 Division of Gastroenterology, Shenzhen Children’s Hospital, Shenzhen, Guangdong, China

5 Shenzhen Following Precision Medical Research Institute, Shenzhen, Guangdong, China

6 Clinical Laboratory, Longgang Central Hospital of Shenzhen, Guangdong, China

7 Shenzhen Imuno Biotech Co., Ltd

8 Division of Neonatology, Children’s Hospital of Fudan University, Shanghai, China

9 Key Laboratory of Birth Defects, Children’s Hospital of Fudan University, Shanghai, China

*Correspondence: Mingbang Wang: Mingbang.wang.bgi@qq.com; Ruihuan Xu: xrh69@126.com; Equal contribution for Jiaxiu Zhou, Feng Yang and Xiaoge Li.

Published: 10/25/2016

ABSTRACT

Chromosomal microarray (CMA) has been suggested as a first tier clinical diagnostic test for ASD. High-throughput sequencing (HTS) has associated hundreds of genes associated with ASD. Whole Exome Sequencing (WES) was used in combination with CMA to identify clinically-relevant ASD variants. In prior work, a trio-based (father, mother, and proband) WGS (Whole Genome Sequencing) was used to reveal clinically-relevant de novo, or inherited, rare variants in half (16 / 32) of the ASD families in which all probands had normal, or VOUS (Variant of Uncertain Clinical Significance), CMA results. In this study, after CMA screening chromosome structural abnormalities of a proband affected with ASD, a WES was performed on the patient and parents. Some rare de novo, and inherited, variants were detected using trio-based bioinformatics analysis. ASD variants were ranked by SFARI Gene score, HPO (human phenotype ontology), protein function damage, and manual searching PubMed.

Sanger sequencing was used to validated some candidate variants in family members. A de novo homozygous mutation in SPG11 (p.C209F), two inherited, compound-heterozygote mutations in SCN9A (p.Q10R and p.R1893H) and BEST1 (p.A135V and p.A297V) were confirmed. Heterozygous mutations in TSC1 (p.S487C) and SHANK2 (p.Arg569His) inherited from mother were also confirmed.

1 INTRODUCTION

Presently approximately 1 % of the total population is affected by autism spectrum disorders (ASD) and the number continues to rise[1]. Multiple evidentiary lines suggest that ASD has a strong genetic background. Approximately 10 % of ASD can be detected by rare chromosomal structural abnormalities and copy number variations (CNVs)[2]. Chromosomal microarray (CMA) has been suggested as a first-tier ASD clinical diagnostic test. ASD patients with normal CMA results might also undergo single-gene disorder testing. An example would be genes for Fragile X Syndrome and Rett Syndrome. This study screened for chromosome structural abnormalities in the affected proband with ASD by CMA. No clinically relevant copy number gain, or loss, was detected.

A Whole Exome Sequencing (WES) of the proband and the parents was then performed. Rare de novo, or inherited rare candidate variants were detected using trio-based bioinformatics analysis. The variants were ranked according to: SFARI Gene score[8]; human phenotype ontology (HPO); protein-function damage; and manually-searched PubMed for prior studies. Candidate variants in this family were validated via Sanger sequencing. A de novo homozygous variant in SPG11(p.C209F), two inherited compound heterozygote mutations in SCN9A (p.Q10R and p.R1893H) and BEST1 (p.A135V and p.A297V), and two, rare, maternally-inherited heterozygous variants in TSC1 (p.S487C) and SHANK2 (p.Arg569His) were confirmed. The variants detected by trio WES might explain the presence of this phenotype of the proband in this family.

2 MATERIALS AND METHODS

2.1 Participant Introduction

The proband (III-1) is a 2.5 year-old boy with ASD. He was delivered preterm at 34 weeks by cesarean section with premature rupture of the membranes and low birth weight (2.5 kg). There may have been an early intrauterine infection as the C-reactive protein (CRP) concentration was 9mg/L and 54 mg/L at day one and three after birth, respectively. Normal CRP level is < 8 mg/L. CRP level dropped to < 1 mg/L after an intravenous injection of the antibiotics Azlocillin and Rocephin at day six after birth.

Abnormal communication behavior was observed at 1.5 years old. He had no verbal, or body language, no communication, no eye contact, no response to his name, and a lack of attachment to parents. Restricted and repetitive behaviors were observed, such as walking in circles, watching TV ads without response, repetitive door closing, and tiptoe walking. Other clinical features included normal hearing, a broken right hand palmprint, EEG boundaries, and abnormally short sleeping times.

Informed consent was obtained for all participating family members. The study was performed in accordance with the Helsinki Declaration protocols and was approved of by the Shenzhen Childrens’ Hospital Ethics Committee. The proband and relatives were interviewed to obtain a comprehensive clinical history in order to rule out autism spectrum disorder.

Sample Collection, CMA, and Whole Exome Sequencing 3

Peripheral blood in the amounts of 305 mil was drawn from the proband, parents, and other family members. Genomic DNA was extracted using Magbind Blood DNA Kit (CW Biotech, Beijing, China) according to manufacturer instructions and stored in a freezer at -20 ℃. CMA was performed with a CytoScan® HD array kit (Thermo Fisher, Hudson, New Hampshire, USA) run in GeneChip® System 3000Dx (Thermo Fisher, Hudson, New Hampshire, USA). Whole Exome was obtained using SureSelect Human All-Exon V5 (Agilent, Santa Clara, CA, USA) and sequenced with Illumina Hiseq X-ten (Illumina, San Diego, CA, USA) in the paired-end 150bp mode. Ten G of raw data (or 100 X depth) was generated for each sample.

Rare de novo and inherited calling

Clean reads were first generated by a moving remove adapter (GATCGGAAGAGCACACGTCT and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT) and filtered out read with low quality by Trimmomatic.

2.2 Rare Variants Prioritization and Phenotype Evaluation

Variants with MAF (Minor Allele Frequency) of less than 0.05 in 1000 genomes or our inhouse database were filtered. Candidate autism gene mutations according to autism gene lists were downloaded from the SFARI gene database[8] on Feb. 28, 2016 and filtered.

The following genes were used as inputs: S-symdromic; 1) high confidence; 2) strong candidate; 3) suggestive evidence; and, 4) minimal evidence were used as next the HPO term (autism, or a phenotype similar to autism) was used to predict that the gene might be autism-related according to phenotype. Finally, variant prioritization was done according to protein conservation and a SIFT damage prediction score by SIFT[14] and PolyPhen-2[15].

Sanger sequencing to confirm candidate variants in the family

PCR (Polymerase Chain Reaction) was performed with the ABI9700 PCR system (Thermo Fisher, Hudson, New Hampshire, USA) using the primer listed in Supplementary Table 1.. The PCR product was sequenced using an ABI 3730xl sequencer (Thermo Fisher, Hudson, New Hampshire, USA).

3 RESULTS

3.1 Proband Clinical Evaluation Copy Number Variations Detection

CMA can detect “copy number variations” (CNVs) and has been suggested as a first-tier clinical ASD diagnostic test. In this study, no clinical relevant copy number loss, or gain, was found in the proband.

3.2 Whole Exome Sequencing and Variants Prioritization

Whole Exome Sequencing was performed on the father-mother-proband trio at an averaged 100-fold depth. The de novo, and inherited, variants were called from this trio (father-mother-proband) according to our previous study[13]. A pipeline was used to identify candidate variants (see Fig. 1). Candidate variants identified in the proband appear in Table 1.

FIGURE 1
Fig. 1 Flowchart to Detect Rare Relevant Variants in Suspected ASD Patient

Abbreviations: WES, whole exome sequencing; VOUS, variant of uncertain clinical significance; HPO, human phenotype ontology. After CMA screening of chromosome structural abnormalities, WES was performed on the patient and the parents, rare de novo (MAF <= 0.05) or inherited variants were ranked by SFARI Gene score, HPO (human phenotype ontology) and protein function damaging, Sanger sequencing, and PubMed were used to identify clinically inherited variants.

TABLE 1
Table 1. Clinically Relevant Variants Identified in the ASD Proband
3.3 Sanger Sequencing Validation

Sanger sequencing was used to confirm variants in the trio and other members that had not undergone WES. A de novo homozygous variant in SPG11 (p.C209F) from the proband (III-1) was confirmed.

Compound heterozygous mutations in SCN9A (p.Q10R and p.R1893H) in the proband, the proband’s mother (II-1) and father (II-2) were confirmed. The mother and father carried heterozygous mutations in SCN9A (p.Q10R) and SCN9A (p.R1893H), respectively.

That the maternal grandfather (I-1) and grandfather (I-2) were carriers for heterozygous mutations in SCN9A (p.R1893H) and SCN9A (p.Q10R), respectively, was confirmed. Other compound heterozygous mutations in BEST1 (p.A135V and p.A297V) were confirmed. The heterozygous mutations in BEST1 (p.A135V) and BEST1 (p.A297V) were inherited from the proband’s mother (II-1) and father (II-2), respectively.

Two heterozygous mutations, one in SHANK2 (p.Arg569His), and one in TSC1 (p.S487C), inherited from Proband’s mother (II-1), were identified. Results appear in Fig. 2.

FIGURE 2
Fig. 2 Clinically Relevant Variants Detected in the Family
Squares indicate a male and circles indicate a female.

A blacked in symbol indicates an individual with ASD. An open symbol indicates an unaffected individual. Arrows indicate the presence of an ASD proband in the family. II-1, II-2, and III-1 are trios for WES.

A “+” indicates the allele containing the reference.

A “+/+” indicates genes on the autosomal chromosome or the X chromosome in female; SCN9A p.Q10R/+, SCN9A p.R1893H/+, SPG11 p.C209F, BEST1 p.A135V/+, BEST1 p.A297V/+, TSC1 p.S487C/+, SHANK2 p.Arg569His/+ and confirmed by Sanger sequencing in II-1, II-2, and III-1, and only SCN9A p.Q10R/+ and SCN9A p.R1893H/+ are confirmed in other family members.

4 DISCUSSION

CMA is recommended as a first-tier ASD genetic diagnosis. Many clinically relevant chromosomal abnormalities have been identified but diagnostic yields are only around 10 % even though many chromosomal abnormalities have been annotated with VOUS. HTS is widely used in ASD genetic studies and many ASD relevant genes have been identified[4, 5]. Clinically relevant variants in 50 % of Canadian ASD families with negative CMA results by WGS have been identified[13]. This suggests that HTS can be used to further screen clinically relevant variants in ASD patient having normal, or VOUS, results. This study identified a total of 2.209 Mb of copy number loss in 15q (q11.1 - q11.2) as annotated with VOUS (CMA providers). WES was performed on the proband and his parents. De novo and rare inherited variants in the family were identified. An updated SFARI Gene and HPO database, and damage prediction software, MAF, was used rank the variants. PubMed was manually searched. A de novo homozygous mutation in SPG11 (p.C209F), two inherited compound heterozygote mutations in SCN9A (p.Q10R and p.R1893H) and BEST1 (p.A135V and p.A297V), along with two rare, maternally-inherited heterozygous mutations in TSC1 (p.S487C) and SHANK2 (p.Arg569His) in this proband were confirmed. TSC1 and SHANK2 are known autism genes. TSC1 (p.S487C) leads to Ser to Cys substitution at amino acid 487 in exon 15. TSC1 has been related to syndromic autism in which a small subpopulation will develop autism. The TSC1 SFARI gene score is “S” indicating “syndromic”. Moreover, a loss of TSC1 gene function mutation results in tuberous sclerosis (TS)[16]. Between 25 % to 60 % of TS patients have autism[17]. SHANK2 (p.Arg569His) leads to Arg substitution of Arg for His at amino acid 569. SHANK2 SFARI gene score is “2” indicating “strong candidate”. SHANK2 is a multi-domain scaffolding protein completely localizes to postsynaptic sites of excitatory synapses in the brain[18]. Several studies have identified rare SHANK2 gene mutations in autistic and intellectually disabled individuals[19]. SHANK2-/- mice showed that SHANK2 serve different interrelated functions in glutamate receptor targeting / assembly which can lead to core ASD symptoms[20]. Mutation Taster predicted that these two mutations have disease-causing mutations whereas Polyphen-2 and SIFT suggested that the substitutions are either damaging or probably damaging meaning that the proteins have a high probability of being affected by the mutations. Sanger Sequencing analyses of the parents revealed that only his unaffected mother had the two heterozygous mutations (Fig. 2). Though low penetrance does exist in autism-related genes[21], the results of this study may not support the conclusion that TSC1 (p.S487C) and (p.Arg569His) explain the ASD phenotype in this proband. SCN9A may be a novel autism-related gene. SCN9A, encodes sodium voltage-gated channel alpha subunit 9 or Na(v)1.7, was first reported as a gene related to pain disorders[22]. The SCN9A mutation may cause pain insensitivity and inherited erythromelalgia[23]. It is also reported as a genetic cause for febrile seizures and Dravet syndrome[24, 25]. Epilepsy and ASD can frequently co-occur frequently making some epilepsy genes strong candidates for ASD[26]. This suggests that epilepsy and ASD may share a common biology. Yuen et al. identified the same mutation in SCN9A (p.V205fs) in two siblings affected with ASD[27]. This study confirmed a compound heterozygote mutation in SCN9A (p.Q10R and p.R1893H) in the proband (III-1). The proband’s mother (II-1) and maternal grandfather (I-1) are carriers for SCN9A (p.R1893H). The proband’s father (II-2) and grandfather (I-2) are carriers for SCN9A (p.Q10R). These results provide a clue that SCN9A may play a role in ASD, but further studies are necessary to confirm its role in ASD. Tare disease genes mutated in the proband, such as BEST1 and SPG11 were confirmed. BEST1, which encodes bestrophin 1, is a gene the mutation of which causes autosomal-recessive bestrophinopathy (ARB)[28] and retinoschisis[29]. A compound heterozygous mutation in BEST1 (p.A135V and p.A297V) in the proband, and BEST1 (p.A135V) and BEST1 (p.A297V) as inherited from the proband’s mother (II-1) and father (II-2), respectively, was confirmed. SPG11, encoding spastic paraplegia 11, is a gene whose mutations can cause spastic paraplegia[30], juvenile amyotrophic lateral sclerosis (ALS)[31] and Charcot-Marie-Tooth disease[32]. A de novo mutation in SPG11 (p.C209F) from the proband (III-1) was confirmed. Further clinical evaluation associated with these two genetically-related disorder would be necessary to confirm these disorders.

5 CONCLUSION

We performed WES to the proband-father-mother trio. Bioinformatics analysis and Sanger sequencing confirmed two heterozygous mutations in two known ASD genes, SHANK2 (p.Arg569His) and TSC1 (p.S487C) which were inherited from the proband’s mother (II-1). A compound heterozygote mutation in SCN9A (p.Q10R and p.R1893H) in the proband (III-1) was confirmed which is a gene recently reported in ASD patients.

We also rare disease related mutation, heterozygous mutations BEST1 (p.A135V and p.A297V) and de novo mutation in SPG11 (p.C209F).

Although single proband and lack of functional study, the results of this study may provide direction in identifying other ASD-related mutations.

Figure and Legends

Note: ALS: amyotrophic lateral sclerosis; CMT: Charcot-Marie-Tooth ; ARB: autosomal-recessive bestrophinopathy.

ACKNOWLEDGEMENTS

We are sincerely grateful to the family members for their participation and cooperation in this study. The authors would like to thank the groups that generated Whole Exome Sequencing data from Joint lab between Children’s Hospital of Fudan University and Wuxi NextCODE Co., Ltd. This project was supported by the Shenzhen Science Technology Research & Development Fund (Program No. :JCYJ20130401114111453, JCYJ20140411150159429, JCYJ20140416141331514 and JCYJ20140415151845360); the Shenzhen Science Technology and Innovation Commission, Longgang District Science Fundamental Research fund (Program No. : 201406063001021); the Longgang District Science Technology and Innovation Commission of Shenzhen, and National High Technology Research and Development Programs (“863 Program”) (No. 2015AA020405); and, by Shenzhen Imuno Biotech Co., Ltd (Program No. : 2015A004).

AUTHOR CONTRIBUTIONS

J. Z., R.X., M.B. and S. Z. planned and coordinated the project, M.W, J. L. and R.X. wrote the manuscript; X. L. prepared samples and extracted DNA; Y.X. performed CMA, F.H. and Y.W. conducted WES and bioinformatics analysis. These authors contribute equally to this manuscript.

CONFLICTS OF INTERESTS

Mingbang Wang and Yan Wang received honoraria and research support from Shenzhen Imuno Biotech Co., Ltd. The authors adhered to Journal policies regarding sharing data and materials. There are no other competing interests to declare.

ADDITIONAL FILES

Supplementary Fig. 1: CMA results for the proband.

Supplementary Table 1. : Primers for validation candidate variants.

REFERENCES

1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

How to Cite This Article

Zhou J, Yang F, Li X, Zhou S, He F, Liang J, Wang Y, Wang M, Xu R. Whole-Exome Sequencing Reveals Clinically Relevant Variants in Family Affected with Autism Spectrum Disorder. J Psychiatry Brain Sci. 2016; 1(4): 3; https://doi.org/10.20900/jpbs.20160017

All Rights Reserved © Copyright 2016 Qingres Co., Ltd .

Powered by Qingres Limitd.